Review



rabbit skeletal muscle cytoskeleton  (Cytoskeleton Inc)


Bioz Verified Symbol Cytoskeleton Inc is a verified supplier
Bioz Manufacturer Symbol Cytoskeleton Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    Cytoskeleton Inc rabbit skeletal muscle cytoskeleton
    Rabbit Skeletal Muscle Cytoskeleton, supplied by Cytoskeleton Inc, used in various techniques. Bioz Stars score: 95/100, based on 112 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+skeletal+muscle+cytoskeleton/Actin+protein+pyrene+labeled+rabbit+skeletal+muscle/pm41854080-70-7-10
    Average 95 stars, based on 112 article reviews
    rabbit skeletal muscle cytoskeleton - by Bioz Stars, 2026-09
    95/100 stars

    Images

    Related Articles

    other:

    Article Title: Molecular mechanism for direct actin force-sensing by α-catenin
    Article Snippet: Key resources table Reagent type (species) or resource Designation Source or reference Identifiers Additional information Recombinant DNA Reagent pET His-Strep-TEV and pET His-StrepTEV-Halo vectors This paper Ampicillin resistance; expression vectors for E. coli Contact Alushin Lab for distribution Recombinant DNA Reagent pFastBac Dual Expression Vector ThermoFisher 10712024 Expression vectors for sf9 insect cells Gene (H. sapiens) Vinculin; HsVCL isoform 1 Synthesized by Genewiz UniProt:P18206-2 Gene (H. sapiens) Metavinculin; HsVCL isoform 2 Synthesized by Genewiz UniProt:P18206-1 Gene (H. sapiens) aE-catenin; HsCTNNA1 Addgene # 24194 UniProt:P35221 Strain, strain background (E. coli) Rosetta2 (DE3) Novagen 71400–4 E. coli strain for protein expression Cell line (S. frugiperda) Gibco Sf9 insect cell ThermoFisher 11496015 Insect cell line for protein expression Transfected construct (S. frugiperda) Gibco Bac-to-Bac Baculovirus Expression System ThermoFisher 10359016 Insect cell line transfection kit for protein expression Chemical compound, drug Halo-tag ligand amine O4 Promega P6741 Synthetic precursor for the fluorescent dye JF-646-Halo Chemical compound, drug JF-646 NHS-ester building block TOCRIS 6148 Synthetic precursor for the fluorescent dye JF-646-Halo Chemical compound, drug HaloTag Alexa Fluor 488 Ligand Promega G1001 Chemical compound, drug Alexa Fluor 555-Phalloidin ThermoFisher A34055 Biological sample (O. cuniculus) Actin Protein (Rhodamine): Rabbit Skeletal Muscle Cytoskeleton, Inc AR05-C Biological sample (O. cuniculus) Actin Protein (Biotin): Rabbit Skeletal Muscle Cytoskeleton, Inc AB07-C Other Streptavidin Coated Polystyrene Particles Spherotech SVP-40–5 Used in optical trapping experiments Other C-flat Holey Carbon Grids for TEM - Gold Only EMS CF313-100-Au Used in cryo-EM experiments Software, algorithm C-trap viewer LUMICKS http://www.nat.vu.nl/ ~iheller/download.html Software, algorithm TWOM viewer LUMICKS http://www.nat.vu.nl/ ~iheller/download.html Software, algorithm ImageJ 1.5 Schneider et al., 2012 https://doi.org/ 10.1038/nmeth.2089 RRID:SCR_003070 ImageJ plugin for TIRF image analysis: https://github.com/ alushinlab/ ActinEnrichment Continued on next page Mei et al. eLife 2020;9:e62514.

    Reverse Transcription:

    Article Title: Spatial proteomics of ER tubules reveals CLMN, an ER-actin tether at focal adhesions that promotes cell migration.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-calnexin Abcam ab22595 RRID:AB_2069006 Mouse anti-mNeonGreen Proteintech 502256466 RRID:AB_2827566 Mouse anti-BirA Novus Biologicals NBP2-59939 N/A IgG-22D5 (SREBP2) McFarlane et al., 201590 N/A Anti-actin Sigma A2066 RRID:AB_476693 Mouse anti-RTN4 Santa Cruz sc-271878 RRID:AB_10709573 Rabbit anti-GFP Abcam ab290 RRID:AB_303395 Rabbit anti-CLMN Atlas Antibodies HPA012634 RRID:AB_1846973 Mouse anti-paxillin BD Biosciences 610051 RRID:AB_397463 Rat anti-tubulin Abcam ab6160 RRID:AB_305328 Rabbit anti-tubulin Proteintech 80762-1-RR RRID:AB_2918911 Mouse anti-Nups (mAb414) BioLegend 902907 RRID:AB_2734672 Rabbit anti-zyxin Millipore Sigma Z4751 RRID:AB_477650 Mouse anti-integrin beta 1 Abcam ab30394 RRID:AB_775726 Rabbit anti-alpha actinin Abcam ab108198 RRID:AB_10858236 Rabbit anti-MYH9 Proteintech 11128-1-AP RRID:AB_2147294 Rabbit anti-Nesprin 4 Proteintech 26467-1-AP RRID: AB_2880526 Rabbit anti-GAPDH Abcam ab9485 RRID:AB_307275 Rabbit anti-STIM1 Cell Signaling Technologies 4916 RRID:AB_2271287 Goat anti-Rabbit HRP Abcam ab6721 RRID:AB_955447 Rabbit anti-mouse HRP Abcam ab6728 RRID:AB_955440 Goat anti-Rat HRP Abcam ab205720 RRID:AB_2941939 Goat anti-rabbit IgG HRP Jackson Immuno 111-035-144 RRID:AB_2307391 Alexa Fluor 488 goat anti-rabbit Thermo Fisher A11034 RRID:AB_2576217 Alexa Fluor 488 Donkey anti-mouse Thermo Fisher A21202 RRID:AB_141607 Rhodamine RedX Donkey anti-rabbit Jackson Immuno 711-295-152 RRID:AB_2340613 Rhodamine RedX goat anti-mouse Jackson Immuno 115-295-146 RRID:AB_2338766 Alexa Fluor 647 Donkey anti-rabbit Thermo Fisher A32795 RRID:AB_2762835 Alexa Fluor 647 Goat anti-mouse Thermo Fisher A3272872 RRID:AB_2633277 Chemicals, peptides, and recombinant proteins Puromycin Gibco A11138 N/A G418 Invivogen ant-gn-1 N/A 0.25% trypsin-EDTA Sigma T4049 N/A DMEM high glucose Gibco 11965 N/A Heat-inactivated FBS Sigma F4135 N/A Penicillin-streptomycin Sigma P4333 N/A 25 mM HEPES Sigma H0887 N/A GlutaMAX supplement Thermo Fisher 35050061 N/A Auto-induction Media Formedium AIMLB0210 N/A T4 Polynucleotide Kinase NEB M0201 N/A T4 Ligase buffer NEB M0202 N/A BbsI NEB R0539 N/A Antarctic Phosphatase NEB M0289 N/A (Continued on next page) 20 Cell Reports 44, 115502, April 22, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Gibson Assembly Mastermix NEB E2611 N/A Lipofectamine 3000 Thermo Fisher L3000 N/A Lipofectamine RNAiMAX Invitrogen 13778 N/A Opti-MEM Gibco 11058 N/A Trizol Life Technologies 15596018 N/A iScript Reverse Transcription Supermix Bio-Rad 1708841 N/A SsoAdvanced Universal SYBR Green Supermix Bio-Rad 1725274 N/A Halt protease inhibitor Thermo Scientific 78429 N/A Halt protease/phosphatase inhibitor Thermo Scientific 78440 N/A Protease inhibitor Tablets, EDTA-free Thermo Scientific A32965 N/A Anti-foam 204 Sigma-Aldrich 1003483364 N/A NcoI NEB R0193 N/A BamHI NEB R0136 N/A Mini-PROTEAN Precast TGX gel Bio-Rad 45610 N/A blotting grade blocker Bio-Rad 1706404 N/A Clarity ECL reagent Bio-Rad 1705061 N/A Clarity Max ECL reagent Bio-Rad 1705062 N/A Coomassie Brilliant Blue R250 Fisher BP101-50 N/A Fluorobrite DMEM Gibco A1896701 N/A mitomycin Millipore Sigma M5353 N/A Methyl beta cyclodextrin Cyclodextrin Technologies Development TRMB-P N/A 25-hydroxycholesterol Steraloids C6510-000 N/A Actin from rabbit skeletal muscle Cytoskeleton, In. .. AKL99 N/A Nocodazole Millipore Sigma M1404 N/A Coomassie Brilliant Blue R250 Fisher BP101-50 N/A Ponceau S Sigma P3504 N/A biotin Sigma B4501 N/A Critical commercial assays Pierce Detergent-Compatible Bradford assay Thermo Scientific 23246 N/A Pierce Silver Stain kit Thermo Scientific 24612 N/A Deposited data Raw MS data This study MassIVE: MSV000096591 Experimental models: Cell lines

    SYBR Green Assay:

    Article Title: Spatial proteomics of ER tubules reveals CLMN, an ER-actin tether at focal adhesions that promotes cell migration.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-calnexin Abcam ab22595 RRID:AB_2069006 Mouse anti-mNeonGreen Proteintech 502256466 RRID:AB_2827566 Mouse anti-BirA Novus Biologicals NBP2-59939 N/A IgG-22D5 (SREBP2) McFarlane et al., 201590 N/A Anti-actin Sigma A2066 RRID:AB_476693 Mouse anti-RTN4 Santa Cruz sc-271878 RRID:AB_10709573 Rabbit anti-GFP Abcam ab290 RRID:AB_303395 Rabbit anti-CLMN Atlas Antibodies HPA012634 RRID:AB_1846973 Mouse anti-paxillin BD Biosciences 610051 RRID:AB_397463 Rat anti-tubulin Abcam ab6160 RRID:AB_305328 Rabbit anti-tubulin Proteintech 80762-1-RR RRID:AB_2918911 Mouse anti-Nups (mAb414) BioLegend 902907 RRID:AB_2734672 Rabbit anti-zyxin Millipore Sigma Z4751 RRID:AB_477650 Mouse anti-integrin beta 1 Abcam ab30394 RRID:AB_775726 Rabbit anti-alpha actinin Abcam ab108198 RRID:AB_10858236 Rabbit anti-MYH9 Proteintech 11128-1-AP RRID:AB_2147294 Rabbit anti-Nesprin 4 Proteintech 26467-1-AP RRID: AB_2880526 Rabbit anti-GAPDH Abcam ab9485 RRID:AB_307275 Rabbit anti-STIM1 Cell Signaling Technologies 4916 RRID:AB_2271287 Goat anti-Rabbit HRP Abcam ab6721 RRID:AB_955447 Rabbit anti-mouse HRP Abcam ab6728 RRID:AB_955440 Goat anti-Rat HRP Abcam ab205720 RRID:AB_2941939 Goat anti-rabbit IgG HRP Jackson Immuno 111-035-144 RRID:AB_2307391 Alexa Fluor 488 goat anti-rabbit Thermo Fisher A11034 RRID:AB_2576217 Alexa Fluor 488 Donkey anti-mouse Thermo Fisher A21202 RRID:AB_141607 Rhodamine RedX Donkey anti-rabbit Jackson Immuno 711-295-152 RRID:AB_2340613 Rhodamine RedX goat anti-mouse Jackson Immuno 115-295-146 RRID:AB_2338766 Alexa Fluor 647 Donkey anti-rabbit Thermo Fisher A32795 RRID:AB_2762835 Alexa Fluor 647 Goat anti-mouse Thermo Fisher A3272872 RRID:AB_2633277 Chemicals, peptides, and recombinant proteins Puromycin Gibco A11138 N/A G418 Invivogen ant-gn-1 N/A 0.25% trypsin-EDTA Sigma T4049 N/A DMEM high glucose Gibco 11965 N/A Heat-inactivated FBS Sigma F4135 N/A Penicillin-streptomycin Sigma P4333 N/A 25 mM HEPES Sigma H0887 N/A GlutaMAX supplement Thermo Fisher 35050061 N/A Auto-induction Media Formedium AIMLB0210 N/A T4 Polynucleotide Kinase NEB M0201 N/A T4 Ligase buffer NEB M0202 N/A BbsI NEB R0539 N/A Antarctic Phosphatase NEB M0289 N/A (Continued on next page) 20 Cell Reports 44, 115502, April 22, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Gibson Assembly Mastermix NEB E2611 N/A Lipofectamine 3000 Thermo Fisher L3000 N/A Lipofectamine RNAiMAX Invitrogen 13778 N/A Opti-MEM Gibco 11058 N/A Trizol Life Technologies 15596018 N/A iScript Reverse Transcription Supermix Bio-Rad 1708841 N/A SsoAdvanced Universal SYBR Green Supermix Bio-Rad 1725274 N/A Halt protease inhibitor Thermo Scientific 78429 N/A Halt protease/phosphatase inhibitor Thermo Scientific 78440 N/A Protease inhibitor Tablets, EDTA-free Thermo Scientific A32965 N/A Anti-foam 204 Sigma-Aldrich 1003483364 N/A NcoI NEB R0193 N/A BamHI NEB R0136 N/A Mini-PROTEAN Precast TGX gel Bio-Rad 45610 N/A blotting grade blocker Bio-Rad 1706404 N/A Clarity ECL reagent Bio-Rad 1705061 N/A Clarity Max ECL reagent Bio-Rad 1705062 N/A Coomassie Brilliant Blue R250 Fisher BP101-50 N/A Fluorobrite DMEM Gibco A1896701 N/A mitomycin Millipore Sigma M5353 N/A Methyl beta cyclodextrin Cyclodextrin Technologies Development TRMB-P N/A 25-hydroxycholesterol Steraloids C6510-000 N/A Actin from rabbit skeletal muscle Cytoskeleton, In. .. AKL99 N/A Nocodazole Millipore Sigma M1404 N/A Coomassie Brilliant Blue R250 Fisher BP101-50 N/A Ponceau S Sigma P3504 N/A biotin Sigma B4501 N/A Critical commercial assays Pierce Detergent-Compatible Bradford assay Thermo Scientific 23246 N/A Pierce Silver Stain kit Thermo Scientific 24612 N/A Deposited data Raw MS data This study MassIVE: MSV000096591 Experimental models: Cell lines

    Protease Inhibitor:

    Article Title: Spatial proteomics of ER tubules reveals CLMN, an ER-actin tether at focal adhesions that promotes cell migration.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-calnexin Abcam ab22595 RRID:AB_2069006 Mouse anti-mNeonGreen Proteintech 502256466 RRID:AB_2827566 Mouse anti-BirA Novus Biologicals NBP2-59939 N/A IgG-22D5 (SREBP2) McFarlane et al., 201590 N/A Anti-actin Sigma A2066 RRID:AB_476693 Mouse anti-RTN4 Santa Cruz sc-271878 RRID:AB_10709573 Rabbit anti-GFP Abcam ab290 RRID:AB_303395 Rabbit anti-CLMN Atlas Antibodies HPA012634 RRID:AB_1846973 Mouse anti-paxillin BD Biosciences 610051 RRID:AB_397463 Rat anti-tubulin Abcam ab6160 RRID:AB_305328 Rabbit anti-tubulin Proteintech 80762-1-RR RRID:AB_2918911 Mouse anti-Nups (mAb414) BioLegend 902907 RRID:AB_2734672 Rabbit anti-zyxin Millipore Sigma Z4751 RRID:AB_477650 Mouse anti-integrin beta 1 Abcam ab30394 RRID:AB_775726 Rabbit anti-alpha actinin Abcam ab108198 RRID:AB_10858236 Rabbit anti-MYH9 Proteintech 11128-1-AP RRID:AB_2147294 Rabbit anti-Nesprin 4 Proteintech 26467-1-AP RRID: AB_2880526 Rabbit anti-GAPDH Abcam ab9485 RRID:AB_307275 Rabbit anti-STIM1 Cell Signaling Technologies 4916 RRID:AB_2271287 Goat anti-Rabbit HRP Abcam ab6721 RRID:AB_955447 Rabbit anti-mouse HRP Abcam ab6728 RRID:AB_955440 Goat anti-Rat HRP Abcam ab205720 RRID:AB_2941939 Goat anti-rabbit IgG HRP Jackson Immuno 111-035-144 RRID:AB_2307391 Alexa Fluor 488 goat anti-rabbit Thermo Fisher A11034 RRID:AB_2576217 Alexa Fluor 488 Donkey anti-mouse Thermo Fisher A21202 RRID:AB_141607 Rhodamine RedX Donkey anti-rabbit Jackson Immuno 711-295-152 RRID:AB_2340613 Rhodamine RedX goat anti-mouse Jackson Immuno 115-295-146 RRID:AB_2338766 Alexa Fluor 647 Donkey anti-rabbit Thermo Fisher A32795 RRID:AB_2762835 Alexa Fluor 647 Goat anti-mouse Thermo Fisher A3272872 RRID:AB_2633277 Chemicals, peptides, and recombinant proteins Puromycin Gibco A11138 N/A G418 Invivogen ant-gn-1 N/A 0.25% trypsin-EDTA Sigma T4049 N/A DMEM high glucose Gibco 11965 N/A Heat-inactivated FBS Sigma F4135 N/A Penicillin-streptomycin Sigma P4333 N/A 25 mM HEPES Sigma H0887 N/A GlutaMAX supplement Thermo Fisher 35050061 N/A Auto-induction Media Formedium AIMLB0210 N/A T4 Polynucleotide Kinase NEB M0201 N/A T4 Ligase buffer NEB M0202 N/A BbsI NEB R0539 N/A Antarctic Phosphatase NEB M0289 N/A (Continued on next page) 20 Cell Reports 44, 115502, April 22, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Gibson Assembly Mastermix NEB E2611 N/A Lipofectamine 3000 Thermo Fisher L3000 N/A Lipofectamine RNAiMAX Invitrogen 13778 N/A Opti-MEM Gibco 11058 N/A Trizol Life Technologies 15596018 N/A iScript Reverse Transcription Supermix Bio-Rad 1708841 N/A SsoAdvanced Universal SYBR Green Supermix Bio-Rad 1725274 N/A Halt protease inhibitor Thermo Scientific 78429 N/A Halt protease/phosphatase inhibitor Thermo Scientific 78440 N/A Protease inhibitor Tablets, EDTA-free Thermo Scientific A32965 N/A Anti-foam 204 Sigma-Aldrich 1003483364 N/A NcoI NEB R0193 N/A BamHI NEB R0136 N/A Mini-PROTEAN Precast TGX gel Bio-Rad 45610 N/A blotting grade blocker Bio-Rad 1706404 N/A Clarity ECL reagent Bio-Rad 1705061 N/A Clarity Max ECL reagent Bio-Rad 1705062 N/A Coomassie Brilliant Blue R250 Fisher BP101-50 N/A Fluorobrite DMEM Gibco A1896701 N/A mitomycin Millipore Sigma M5353 N/A Methyl beta cyclodextrin Cyclodextrin Technologies Development TRMB-P N/A 25-hydroxycholesterol Steraloids C6510-000 N/A Actin from rabbit skeletal muscle Cytoskeleton, In. .. AKL99 N/A Nocodazole Millipore Sigma M1404 N/A Coomassie Brilliant Blue R250 Fisher BP101-50 N/A Ponceau S Sigma P3504 N/A biotin Sigma B4501 N/A Critical commercial assays Pierce Detergent-Compatible Bradford assay Thermo Scientific 23246 N/A Pierce Silver Stain kit Thermo Scientific 24612 N/A Deposited data Raw MS data This study MassIVE: MSV000096591 Experimental models: Cell lines

    Article Title: Ubiquitin-dependent remodeling of the actin cytoskeleton drives cell fusion.
    Article Snippet: Article .. Article .. Article


    Ubiquitin Proteomics:

    Article Title: Ubiquitin-dependent remodeling of the actin cytoskeleton drives cell fusion.
    Article Snippet: Article .. Article .. Article

    Labeling:

    Article Title: Ubiquitin-dependent remodeling of the actin cytoskeleton drives cell fusion.
    Article Snippet: Article .. Article .. Article

    Transfection:

    Article Title: Ubiquitin-dependent remodeling of the actin cytoskeleton drives cell fusion.
    Article Snippet: Article .. Article .. Article

    In Vitro:

    Article Title: Ubiquitin-dependent remodeling of the actin cytoskeleton drives cell fusion.
    Article Snippet: Article .. Article .. Article

    RNA Sequencing:

    Article Title: Ubiquitin-dependent remodeling of the actin cytoskeleton drives cell fusion.
    Article Snippet: Article .. Article .. Article

    Virus:


    Recombinant:


    Article Title: Adhesion-induced cortical flows pattern E-cadherin-mediated cell contacts.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies zebrafish E-cadherin antibody produced in rabbit Maı̂tre et al.20 N/A peroxidase AffiniPure goat anti-rabbit IgG (H+L) Jackson ImmunoResearch Cat#111-035-003; RRID: AB_2313567 Chemicals, peptides, and recombinant proteins zebrafish E-cadherin ectodomain with 12x His-tag This study N/A FreeStyle 293 Expression Medium Gibco Cat#12338018 Polyethylenimine, Linear, MW 25000 Polysciences Cat#23966 Opti-MEM Reduced Serum Medium Gibco Cat#31985062 Sulfo-cyanine5-maleimide Lumiprobe Cat#13380 DMEM/F-12 Gibco Cat#11320033 GlutaMAX Supplement Gibco Cat#35050061 Penicillin-Streptomycin Gibco Cat#15070063 Actin protein (rhodamine) from rabbit skeletal muscle Cytoskeleton, Inc. Cat#AR05-B para-nitro-Blebbistatin K epiró et al.50; Cayman Chemical Cat#24171 1-Oleoyl lysophosphatidic acid sodium salt Tocris Bioscience Cat#3854 SYLGARD 184 PDMS Merck Cat#761036 18:1 (D9-Cis) PC (DOPC) Avanti polar lipids Cat#850375C 18:1 DGS-NTA Avanti polar lipids Cat#790528 DSPE-PEG(2000) Amine Avanti polar lipids Cat#880128 Critical commercial assays mMESSAGE mMACHINE SP6 Transcription Kit Invitrogen Cat#AM1340 Gibson Assembly Cloning Kit NEB Cat#E5510S Gateway Cloning Kit Invitrogen Cat#11791020; Cat#11789020 Experimental models: Cell lines FreeStyle 293-F Cells Gibco Cat#R79007; RRID: CVCL_D603 Experimental models: Organisms/strains Zebrafish: wildtype ABxTL MPI-CBG ZDB-GENO-031202-1 Zebrafish: Tg(cdh1-tdTomato)xt18 Cronan and Tobin31 ZDB-FISH-201125-9 Zebrafish: Tg(cdh1-mlanYFP)xt17 Cronan and Tobin31 ZDB-FISH-201125-8 Zebrafish: Tg(actb2:HA-mCherry2) Xiong et al.73 ZDB-TGCONSTRCT-130625-1 Zebrafish: Tg(actb2:Myl12.1-eGFP;actb2:Utrophin-mCherry) This study N/A Oligonucleotides Morpholino: MO-cdh1 TAAATCGCAGCTCTTCCTTCCAACG Babb and Marrs.30; Gene Tools ZDB-MRPHLNO-050421-2 Primers: EcadDcyto-GFP Forward: GATCTCGAGGTGTCCAAAGGCG This study; Microsynth N/A Primers: EcadDcyto-GFP Reverse: CAGCAGAGGCTCTTTCTTGCTG This study; Microsynth N/A Primers: GFP-AHPH-WT Forward: GCAGGATCCCATCGATTATGGTGAGCAAGGGCGA This study; Microsynth N/A Primers: GFP-AHPH-WT Reverse: CGTAATACG ACTCACTATAGTTTCAAGGCTTTCCA ATAGGTTTGTAGCAA This study; Microsynth N/A Primers: mCherry-AHPH-WT Forward: GCTGTACAAGTCCGGACTCAGATCTCGAGC This study; Microsynth N/A Primers: mCherry-AHPH-WT Reverse: TGAGTCCGGACTTGTACAGCTCGTCCATGCCG This study; Microsynth N/A (Continued on next page) Current Biology 34, 1–12.e1–e8, January 8, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Primers: GFP-AHPH-DM Forward: AATACAAGCTA CTTGTTCTTTTTGCAGGATCCCATCGA TTATGGTGAGCAAGGGCGAG This study; Microsynth N/A Primers: GFP-AHPH-DM Reverse: TCTGGATCTACG TAATACGACTCACTATAGTTCTAGAGGCTCAAGGC TTTCCAATAGGTTTGTAGC This study; Microsynth N/A gBlocks gene fragment: Ftractin ACAAGT TTGTACAAAAAAGCAGGCTTCGGATCCATG GCGCGTCCGAGAGGAGCTGGCCCGTGCT CACCTGGTCTCGAAAGGGCTCCACGGCG GAGCGTAGGTGAGTTGAGACTTTTGTTTGA AGCACGATGCGCTGCGGTCGCTGCTGCTG CTGCAGCTGGGGGGCTAGCGCTACCGCTC GAGGACCCAGCTTTCTTGTACAAAGTGGa IDT N/A Recombinant DNA pcDNA3.1(-)-EcadECD (zebrafish) This study N/A pEGFP-RhoA Biosensor Piekny and Glotzer40 Addgene #68026 GFP-AHPH-DM Priya et al.41 Addgene #71368 PCS2-GFP-AHPH-WT This study N/A PCS2-GFP-AHPH-DM This study N/A PCS2-mCherry-AHPH-WT This study N/A PCS2-Ftractin-GFP This study N/A PCS2-Ftractin-mKO2 This study N/A PCS2-E-cadherin-GFP(zebrafish) Kardash et al.74 N/A PCS2-EcadDcyto-GFP This study N/A PCS2-lefty1 Maı̂tre et al.20 N/A PCS2-membrane-RFP Iioka et al.75 N/A PCS2-CA-Mypt Jayashankar et al.51 N/A PCS2-CA-RhoA Takesono et al.42 N/A PCS2-CA-Ezrin2 Diz-Muñoz et al.58 N/A Software and algorithms Fiji Schindelin et al.76 https://fiji.sc/ MATLAB R2017b The MathWorks, Inc https://mathworks.com/products/ matlab.html Python 3.6 Python Software Foundation https://www.python.org ILASTIK Sommer et al.77 https://www.ilastik.org KymoButler Jakobs et al.78 https://github.com/elifesciences- publications/KymoButler SOAX Xu et al.79 https://www.lehigh.edu/ div206/soax/ Prism 6 GraphPad https://www.graphpad.com/ scientific-software/prism/ Inkscape Inkscape Project (2000) https://inkscape.org Other HisTrap Fast Flow Crude column Cytiva Cat#GE29-0486-31 PD-10 desalting columns Cytiva Cat#17085101 Zeba Spin Desalting Columns 7K MWCO Thermo Scientific Cat#89882 Article e2 Current Biology 34, 1–12.e1–e8, January 8, 2024

    Plasmid Preparation:


    Chromatography:

    Article Title: Regulation of YAP activity by nuclear G-actin binding.
    Article Snippet: When the aborbance of 600 nm reached 0.6 –0.8, 1 mM IPTG (Roth, N08.3) was added to induce protein expression and the baceria were incubated for 16 h. The pellet was centrifuged at 000 rpm for 20 min and lysed by sonication in TBS buffer 20 mM Tris-HCl, 150 mM NaCl, 1 mM β-mercaptoethanol). fter 1 h of 16 000 rpm centrifugation, the lysate was applied o Ni-IDA Resin (Macherey-Nagel, 745210.120) for purificaion. .. Actin protein ( > 99% pure) from rabbit skeletal muscle Cytoskeleton, Inc.) was purchased from tebubio. ize exclusion chromatography he analytical size-exclusion chromatography was performed n an ÄKTA system (GE Healthcare). ..

    Size-exclusion Chromatography:

    Article Title: Regulation of YAP activity by nuclear G-actin binding.
    Article Snippet: When the aborbance of 600 nm reached 0.6 –0.8, 1 mM IPTG (Roth, N08.3) was added to induce protein expression and the baceria were incubated for 16 h. The pellet was centrifuged at 000 rpm for 20 min and lysed by sonication in TBS buffer 20 mM Tris-HCl, 150 mM NaCl, 1 mM β-mercaptoethanol). fter 1 h of 16 000 rpm centrifugation, the lysate was applied o Ni-IDA Resin (Macherey-Nagel, 745210.120) for purificaion. .. Actin protein ( > 99% pure) from rabbit skeletal muscle Cytoskeleton, Inc.) was purchased from tebubio. ize exclusion chromatography he analytical size-exclusion chromatography was performed n an ÄKTA system (GE Healthcare). ..

    Produced:

    Article Title: Adhesion-induced cortical flows pattern E-cadherin-mediated cell contacts.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies zebrafish E-cadherin antibody produced in rabbit Maı̂tre et al.20 N/A peroxidase AffiniPure goat anti-rabbit IgG (H+L) Jackson ImmunoResearch Cat#111-035-003; RRID: AB_2313567 Chemicals, peptides, and recombinant proteins zebrafish E-cadherin ectodomain with 12x His-tag This study N/A FreeStyle 293 Expression Medium Gibco Cat#12338018 Polyethylenimine, Linear, MW 25000 Polysciences Cat#23966 Opti-MEM Reduced Serum Medium Gibco Cat#31985062 Sulfo-cyanine5-maleimide Lumiprobe Cat#13380 DMEM/F-12 Gibco Cat#11320033 GlutaMAX Supplement Gibco Cat#35050061 Penicillin-Streptomycin Gibco Cat#15070063 Actin protein (rhodamine) from rabbit skeletal muscle Cytoskeleton, Inc. Cat#AR05-B para-nitro-Blebbistatin K epiró et al.50; Cayman Chemical Cat#24171 1-Oleoyl lysophosphatidic acid sodium salt Tocris Bioscience Cat#3854 SYLGARD 184 PDMS Merck Cat#761036 18:1 (D9-Cis) PC (DOPC) Avanti polar lipids Cat#850375C 18:1 DGS-NTA Avanti polar lipids Cat#790528 DSPE-PEG(2000) Amine Avanti polar lipids Cat#880128 Critical commercial assays mMESSAGE mMACHINE SP6 Transcription Kit Invitrogen Cat#AM1340 Gibson Assembly Cloning Kit NEB Cat#E5510S Gateway Cloning Kit Invitrogen Cat#11791020; Cat#11789020 Experimental models: Cell lines FreeStyle 293-F Cells Gibco Cat#R79007; RRID: CVCL_D603 Experimental models: Organisms/strains Zebrafish: wildtype ABxTL MPI-CBG ZDB-GENO-031202-1 Zebrafish: Tg(cdh1-tdTomato)xt18 Cronan and Tobin31 ZDB-FISH-201125-9 Zebrafish: Tg(cdh1-mlanYFP)xt17 Cronan and Tobin31 ZDB-FISH-201125-8 Zebrafish: Tg(actb2:HA-mCherry2) Xiong et al.73 ZDB-TGCONSTRCT-130625-1 Zebrafish: Tg(actb2:Myl12.1-eGFP;actb2:Utrophin-mCherry) This study N/A Oligonucleotides Morpholino: MO-cdh1 TAAATCGCAGCTCTTCCTTCCAACG Babb and Marrs.30; Gene Tools ZDB-MRPHLNO-050421-2 Primers: EcadDcyto-GFP Forward: GATCTCGAGGTGTCCAAAGGCG This study; Microsynth N/A Primers: EcadDcyto-GFP Reverse: CAGCAGAGGCTCTTTCTTGCTG This study; Microsynth N/A Primers: GFP-AHPH-WT Forward: GCAGGATCCCATCGATTATGGTGAGCAAGGGCGA This study; Microsynth N/A Primers: GFP-AHPH-WT Reverse: CGTAATACG ACTCACTATAGTTTCAAGGCTTTCCA ATAGGTTTGTAGCAA This study; Microsynth N/A Primers: mCherry-AHPH-WT Forward: GCTGTACAAGTCCGGACTCAGATCTCGAGC This study; Microsynth N/A Primers: mCherry-AHPH-WT Reverse: TGAGTCCGGACTTGTACAGCTCGTCCATGCCG This study; Microsynth N/A (Continued on next page) Current Biology 34, 1–12.e1–e8, January 8, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Primers: GFP-AHPH-DM Forward: AATACAAGCTA CTTGTTCTTTTTGCAGGATCCCATCGA TTATGGTGAGCAAGGGCGAG This study; Microsynth N/A Primers: GFP-AHPH-DM Reverse: TCTGGATCTACG TAATACGACTCACTATAGTTCTAGAGGCTCAAGGC TTTCCAATAGGTTTGTAGC This study; Microsynth N/A gBlocks gene fragment: Ftractin ACAAGT TTGTACAAAAAAGCAGGCTTCGGATCCATG GCGCGTCCGAGAGGAGCTGGCCCGTGCT CACCTGGTCTCGAAAGGGCTCCACGGCG GAGCGTAGGTGAGTTGAGACTTTTGTTTGA AGCACGATGCGCTGCGGTCGCTGCTGCTG CTGCAGCTGGGGGGCTAGCGCTACCGCTC GAGGACCCAGCTTTCTTGTACAAAGTGGa IDT N/A Recombinant DNA pcDNA3.1(-)-EcadECD (zebrafish) This study N/A pEGFP-RhoA Biosensor Piekny and Glotzer40 Addgene #68026 GFP-AHPH-DM Priya et al.41 Addgene #71368 PCS2-GFP-AHPH-WT This study N/A PCS2-GFP-AHPH-DM This study N/A PCS2-mCherry-AHPH-WT This study N/A PCS2-Ftractin-GFP This study N/A PCS2-Ftractin-mKO2 This study N/A PCS2-E-cadherin-GFP(zebrafish) Kardash et al.74 N/A PCS2-EcadDcyto-GFP This study N/A PCS2-lefty1 Maı̂tre et al.20 N/A PCS2-membrane-RFP Iioka et al.75 N/A PCS2-CA-Mypt Jayashankar et al.51 N/A PCS2-CA-RhoA Takesono et al.42 N/A PCS2-CA-Ezrin2 Diz-Muñoz et al.58 N/A Software and algorithms Fiji Schindelin et al.76 https://fiji.sc/ MATLAB R2017b The MathWorks, Inc https://mathworks.com/products/ matlab.html Python 3.6 Python Software Foundation https://www.python.org ILASTIK Sommer et al.77 https://www.ilastik.org KymoButler Jakobs et al.78 https://github.com/elifesciences- publications/KymoButler SOAX Xu et al.79 https://www.lehigh.edu/ div206/soax/ Prism 6 GraphPad https://www.graphpad.com/ scientific-software/prism/ Inkscape Inkscape Project (2000) https://inkscape.org Other HisTrap Fast Flow Crude column Cytiva Cat#GE29-0486-31 PD-10 desalting columns Cytiva Cat#17085101 Zeba Spin Desalting Columns 7K MWCO Thermo Scientific Cat#89882 Article e2 Current Biology 34, 1–12.e1–e8, January 8, 2024

    Expressing:

    Article Title: Adhesion-induced cortical flows pattern E-cadherin-mediated cell contacts.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies zebrafish E-cadherin antibody produced in rabbit Maı̂tre et al.20 N/A peroxidase AffiniPure goat anti-rabbit IgG (H+L) Jackson ImmunoResearch Cat#111-035-003; RRID: AB_2313567 Chemicals, peptides, and recombinant proteins zebrafish E-cadherin ectodomain with 12x His-tag This study N/A FreeStyle 293 Expression Medium Gibco Cat#12338018 Polyethylenimine, Linear, MW 25000 Polysciences Cat#23966 Opti-MEM Reduced Serum Medium Gibco Cat#31985062 Sulfo-cyanine5-maleimide Lumiprobe Cat#13380 DMEM/F-12 Gibco Cat#11320033 GlutaMAX Supplement Gibco Cat#35050061 Penicillin-Streptomycin Gibco Cat#15070063 Actin protein (rhodamine) from rabbit skeletal muscle Cytoskeleton, Inc. Cat#AR05-B para-nitro-Blebbistatin K epiró et al.50; Cayman Chemical Cat#24171 1-Oleoyl lysophosphatidic acid sodium salt Tocris Bioscience Cat#3854 SYLGARD 184 PDMS Merck Cat#761036 18:1 (D9-Cis) PC (DOPC) Avanti polar lipids Cat#850375C 18:1 DGS-NTA Avanti polar lipids Cat#790528 DSPE-PEG(2000) Amine Avanti polar lipids Cat#880128 Critical commercial assays mMESSAGE mMACHINE SP6 Transcription Kit Invitrogen Cat#AM1340 Gibson Assembly Cloning Kit NEB Cat#E5510S Gateway Cloning Kit Invitrogen Cat#11791020; Cat#11789020 Experimental models: Cell lines FreeStyle 293-F Cells Gibco Cat#R79007; RRID: CVCL_D603 Experimental models: Organisms/strains Zebrafish: wildtype ABxTL MPI-CBG ZDB-GENO-031202-1 Zebrafish: Tg(cdh1-tdTomato)xt18 Cronan and Tobin31 ZDB-FISH-201125-9 Zebrafish: Tg(cdh1-mlanYFP)xt17 Cronan and Tobin31 ZDB-FISH-201125-8 Zebrafish: Tg(actb2:HA-mCherry2) Xiong et al.73 ZDB-TGCONSTRCT-130625-1 Zebrafish: Tg(actb2:Myl12.1-eGFP;actb2:Utrophin-mCherry) This study N/A Oligonucleotides Morpholino: MO-cdh1 TAAATCGCAGCTCTTCCTTCCAACG Babb and Marrs.30; Gene Tools ZDB-MRPHLNO-050421-2 Primers: EcadDcyto-GFP Forward: GATCTCGAGGTGTCCAAAGGCG This study; Microsynth N/A Primers: EcadDcyto-GFP Reverse: CAGCAGAGGCTCTTTCTTGCTG This study; Microsynth N/A Primers: GFP-AHPH-WT Forward: GCAGGATCCCATCGATTATGGTGAGCAAGGGCGA This study; Microsynth N/A Primers: GFP-AHPH-WT Reverse: CGTAATACG ACTCACTATAGTTTCAAGGCTTTCCA ATAGGTTTGTAGCAA This study; Microsynth N/A Primers: mCherry-AHPH-WT Forward: GCTGTACAAGTCCGGACTCAGATCTCGAGC This study; Microsynth N/A Primers: mCherry-AHPH-WT Reverse: TGAGTCCGGACTTGTACAGCTCGTCCATGCCG This study; Microsynth N/A (Continued on next page) Current Biology 34, 1–12.e1–e8, January 8, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Primers: GFP-AHPH-DM Forward: AATACAAGCTA CTTGTTCTTTTTGCAGGATCCCATCGA TTATGGTGAGCAAGGGCGAG This study; Microsynth N/A Primers: GFP-AHPH-DM Reverse: TCTGGATCTACG TAATACGACTCACTATAGTTCTAGAGGCTCAAGGC TTTCCAATAGGTTTGTAGC This study; Microsynth N/A gBlocks gene fragment: Ftractin ACAAGT TTGTACAAAAAAGCAGGCTTCGGATCCATG GCGCGTCCGAGAGGAGCTGGCCCGTGCT CACCTGGTCTCGAAAGGGCTCCACGGCG GAGCGTAGGTGAGTTGAGACTTTTGTTTGA AGCACGATGCGCTGCGGTCGCTGCTGCTG CTGCAGCTGGGGGGCTAGCGCTACCGCTC GAGGACCCAGCTTTCTTGTACAAAGTGGa IDT N/A Recombinant DNA pcDNA3.1(-)-EcadECD (zebrafish) This study N/A pEGFP-RhoA Biosensor Piekny and Glotzer40 Addgene #68026 GFP-AHPH-DM Priya et al.41 Addgene #71368 PCS2-GFP-AHPH-WT This study N/A PCS2-GFP-AHPH-DM This study N/A PCS2-mCherry-AHPH-WT This study N/A PCS2-Ftractin-GFP This study N/A PCS2-Ftractin-mKO2 This study N/A PCS2-E-cadherin-GFP(zebrafish) Kardash et al.74 N/A PCS2-EcadDcyto-GFP This study N/A PCS2-lefty1 Maı̂tre et al.20 N/A PCS2-membrane-RFP Iioka et al.75 N/A PCS2-CA-Mypt Jayashankar et al.51 N/A PCS2-CA-RhoA Takesono et al.42 N/A PCS2-CA-Ezrin2 Diz-Muñoz et al.58 N/A Software and algorithms Fiji Schindelin et al.76 https://fiji.sc/ MATLAB R2017b The MathWorks, Inc https://mathworks.com/products/ matlab.html Python 3.6 Python Software Foundation https://www.python.org ILASTIK Sommer et al.77 https://www.ilastik.org KymoButler Jakobs et al.78 https://github.com/elifesciences- publications/KymoButler SOAX Xu et al.79 https://www.lehigh.edu/ div206/soax/ Prism 6 GraphPad https://www.graphpad.com/ scientific-software/prism/ Inkscape Inkscape Project (2000) https://inkscape.org Other HisTrap Fast Flow Crude column Cytiva Cat#GE29-0486-31 PD-10 desalting columns Cytiva Cat#17085101 Zeba Spin Desalting Columns 7K MWCO Thermo Scientific Cat#89882 Article e2 Current Biology 34, 1–12.e1–e8, January 8, 2024

    Cloning:

    Article Title: Adhesion-induced cortical flows pattern E-cadherin-mediated cell contacts.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies zebrafish E-cadherin antibody produced in rabbit Maı̂tre et al.20 N/A peroxidase AffiniPure goat anti-rabbit IgG (H+L) Jackson ImmunoResearch Cat#111-035-003; RRID: AB_2313567 Chemicals, peptides, and recombinant proteins zebrafish E-cadherin ectodomain with 12x His-tag This study N/A FreeStyle 293 Expression Medium Gibco Cat#12338018 Polyethylenimine, Linear, MW 25000 Polysciences Cat#23966 Opti-MEM Reduced Serum Medium Gibco Cat#31985062 Sulfo-cyanine5-maleimide Lumiprobe Cat#13380 DMEM/F-12 Gibco Cat#11320033 GlutaMAX Supplement Gibco Cat#35050061 Penicillin-Streptomycin Gibco Cat#15070063 Actin protein (rhodamine) from rabbit skeletal muscle Cytoskeleton, Inc. Cat#AR05-B para-nitro-Blebbistatin K epiró et al.50; Cayman Chemical Cat#24171 1-Oleoyl lysophosphatidic acid sodium salt Tocris Bioscience Cat#3854 SYLGARD 184 PDMS Merck Cat#761036 18:1 (D9-Cis) PC (DOPC) Avanti polar lipids Cat#850375C 18:1 DGS-NTA Avanti polar lipids Cat#790528 DSPE-PEG(2000) Amine Avanti polar lipids Cat#880128 Critical commercial assays mMESSAGE mMACHINE SP6 Transcription Kit Invitrogen Cat#AM1340 Gibson Assembly Cloning Kit NEB Cat#E5510S Gateway Cloning Kit Invitrogen Cat#11791020; Cat#11789020 Experimental models: Cell lines FreeStyle 293-F Cells Gibco Cat#R79007; RRID: CVCL_D603 Experimental models: Organisms/strains Zebrafish: wildtype ABxTL MPI-CBG ZDB-GENO-031202-1 Zebrafish: Tg(cdh1-tdTomato)xt18 Cronan and Tobin31 ZDB-FISH-201125-9 Zebrafish: Tg(cdh1-mlanYFP)xt17 Cronan and Tobin31 ZDB-FISH-201125-8 Zebrafish: Tg(actb2:HA-mCherry2) Xiong et al.73 ZDB-TGCONSTRCT-130625-1 Zebrafish: Tg(actb2:Myl12.1-eGFP;actb2:Utrophin-mCherry) This study N/A Oligonucleotides Morpholino: MO-cdh1 TAAATCGCAGCTCTTCCTTCCAACG Babb and Marrs.30; Gene Tools ZDB-MRPHLNO-050421-2 Primers: EcadDcyto-GFP Forward: GATCTCGAGGTGTCCAAAGGCG This study; Microsynth N/A Primers: EcadDcyto-GFP Reverse: CAGCAGAGGCTCTTTCTTGCTG This study; Microsynth N/A Primers: GFP-AHPH-WT Forward: GCAGGATCCCATCGATTATGGTGAGCAAGGGCGA This study; Microsynth N/A Primers: GFP-AHPH-WT Reverse: CGTAATACG ACTCACTATAGTTTCAAGGCTTTCCA ATAGGTTTGTAGCAA This study; Microsynth N/A Primers: mCherry-AHPH-WT Forward: GCTGTACAAGTCCGGACTCAGATCTCGAGC This study; Microsynth N/A Primers: mCherry-AHPH-WT Reverse: TGAGTCCGGACTTGTACAGCTCGTCCATGCCG This study; Microsynth N/A (Continued on next page) Current Biology 34, 1–12.e1–e8, January 8, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Primers: GFP-AHPH-DM Forward: AATACAAGCTA CTTGTTCTTTTTGCAGGATCCCATCGA TTATGGTGAGCAAGGGCGAG This study; Microsynth N/A Primers: GFP-AHPH-DM Reverse: TCTGGATCTACG TAATACGACTCACTATAGTTCTAGAGGCTCAAGGC TTTCCAATAGGTTTGTAGC This study; Microsynth N/A gBlocks gene fragment: Ftractin ACAAGT TTGTACAAAAAAGCAGGCTTCGGATCCATG GCGCGTCCGAGAGGAGCTGGCCCGTGCT CACCTGGTCTCGAAAGGGCTCCACGGCG GAGCGTAGGTGAGTTGAGACTTTTGTTTGA AGCACGATGCGCTGCGGTCGCTGCTGCTG CTGCAGCTGGGGGGCTAGCGCTACCGCTC GAGGACCCAGCTTTCTTGTACAAAGTGGa IDT N/A Recombinant DNA pcDNA3.1(-)-EcadECD (zebrafish) This study N/A pEGFP-RhoA Biosensor Piekny and Glotzer40 Addgene #68026 GFP-AHPH-DM Priya et al.41 Addgene #71368 PCS2-GFP-AHPH-WT This study N/A PCS2-GFP-AHPH-DM This study N/A PCS2-mCherry-AHPH-WT This study N/A PCS2-Ftractin-GFP This study N/A PCS2-Ftractin-mKO2 This study N/A PCS2-E-cadherin-GFP(zebrafish) Kardash et al.74 N/A PCS2-EcadDcyto-GFP This study N/A PCS2-lefty1 Maı̂tre et al.20 N/A PCS2-membrane-RFP Iioka et al.75 N/A PCS2-CA-Mypt Jayashankar et al.51 N/A PCS2-CA-RhoA Takesono et al.42 N/A PCS2-CA-Ezrin2 Diz-Muñoz et al.58 N/A Software and algorithms Fiji Schindelin et al.76 https://fiji.sc/ MATLAB R2017b The MathWorks, Inc https://mathworks.com/products/ matlab.html Python 3.6 Python Software Foundation https://www.python.org ILASTIK Sommer et al.77 https://www.ilastik.org KymoButler Jakobs et al.78 https://github.com/elifesciences- publications/KymoButler SOAX Xu et al.79 https://www.lehigh.edu/ div206/soax/ Prism 6 GraphPad https://www.graphpad.com/ scientific-software/prism/ Inkscape Inkscape Project (2000) https://inkscape.org Other HisTrap Fast Flow Crude column Cytiva Cat#GE29-0486-31 PD-10 desalting columns Cytiva Cat#17085101 Zeba Spin Desalting Columns 7K MWCO Thermo Scientific Cat#89882 Article e2 Current Biology 34, 1–12.e1–e8, January 8, 2024



    Similar Products

    95
    Cytoskeleton Inc rabbit skeletal muscle cytoskeleton
    Rabbit Skeletal Muscle Cytoskeleton, supplied by Cytoskeleton Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+skeletal+muscle+cytoskeleton/Actin+protein+pyrene+labeled+rabbit+skeletal+muscle/pm41854080-70-7-10
    Average 95 stars, based on 1 article reviews
    rabbit skeletal muscle cytoskeleton - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    96
    Cytoskeleton Inc akl99 rhodamine g actin cytoskeleton
    Akl99 Rhodamine G Actin Cytoskeleton, supplied by Cytoskeleton Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+skeletal+muscle+cytoskeleton/Actin+protein+pure+rabbit+skeletal+muscle/pm41405989-295-67-70
    Average 96 stars, based on 1 article reviews
    akl99 rhodamine g actin cytoskeleton - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    95
    Cytoskeleton Inc v000777 myosin skeletal muscle s1 fragments cytoskeleton
    V000777 Myosin Skeletal Muscle S1 Fragments Cytoskeleton, supplied by Cytoskeleton Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+skeletal+muscle+cytoskeleton/Myosin+II+protein+rabbit+skeletal+muscle/pm41296566-456-137-143
    Average 95 stars, based on 1 article reviews
    v000777 myosin skeletal muscle s1 fragments cytoskeleton - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    95
    Cytoskeleton Inc my02 chicken gizzard smmii cytoskeleton
    My02 Chicken Gizzard Smmii Cytoskeleton, supplied by Cytoskeleton Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+skeletal+muscle+cytoskeleton/Myosin+II+protein+rabbit+skeletal+muscle/pm40602401-260-91-95
    Average 95 stars, based on 1 article reviews
    my02 chicken gizzard smmii cytoskeleton - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    94
    Cytoskeleton Inc actin cytoskeleton oxidative phosphorylation valine
    Actin Cytoskeleton Oxidative Phosphorylation Valine, supplied by Cytoskeleton Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+skeletal+muscle+cytoskeleton/Actin+protein+pure+rabbit+skeletal+muscle/pm40538500-181-38-39
    Average 94 stars, based on 1 article reviews
    actin cytoskeleton oxidative phosphorylation valine - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    Cytoskeleton Inc actin cytoskeleton protein
    Actin Cytoskeleton Protein, supplied by Cytoskeleton Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+skeletal+muscle+cytoskeleton/Actin+protein+pure+rabbit+skeletal+muscle/pmc12176871-225-9-10
    Average 94 stars, based on 1 article reviews
    actin cytoskeleton protein - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    96
    Cytoskeleton Inc actin cytoskeleton akl99
    Actin Cytoskeleton Akl99, supplied by Cytoskeleton Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+skeletal+muscle+cytoskeleton/Actin+protein+-+rabbit+skeletal+muscle+%3E99%25+pure/bio_rxiv__2024__07__19__604346-192-20-21
    Average 96 stars, based on 1 article reviews
    actin cytoskeleton akl99 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    95
    Cytoskeleton Inc rhodamine muscle actin cytoskeleton
    Rhodamine Muscle Actin Cytoskeleton, supplied by Cytoskeleton Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+skeletal+muscle+cytoskeleton/Actin+protein+-+rhodamine%2C+rabbit+skeletal+muscle/pm38728140-168-71-74
    Average 95 stars, based on 1 article reviews
    rhodamine muscle actin cytoskeleton - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    96
    Cytoskeleton Inc chemical cytoskeleton cytoskeletal part motor activity microtubule cytoskeleton microtubule
    Chemical Cytoskeleton Cytoskeletal Part Motor Activity Microtubule Cytoskeleton Microtubule, supplied by Cytoskeleton Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rabbit+skeletal+muscle+cytoskeleton/Actin+protein+-+rabbit+skeletal+muscle+%3E95%25+pure/pm38702310-189-107-108
    Average 96 stars, based on 1 article reviews
    chemical cytoskeleton cytoskeletal part motor activity microtubule cytoskeleton microtubule - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    Image Search Results